Mechanisms of quinolone resistance in clinical isolates of Shigella dysenteriae.

In gram-negative bacteria, gyrase and topoisomerase IV are primary and secondary targets, respectively, of the fluoroquinolones. In addition to the mutations in the genes encoding the target enzymes (1, 4), quinolone resistance may also be associated with increased efflux of the drugs (2, 5). Possible mechanisms of quinolone resistance were investigated in clinical isolates of Shigella dysenteriae obtained from the International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh (AK) and the National Institute of Cholera and Enteric Diseases, Calcutta, India (CI, DS, IPB, and IMC). The quinolone resistance-determining regions (QRDR) of gyrA and parC were amplified with the primer pairs 59TACACCG GTCAACATTGAGG39-59TTAATGATTGCCGCCGTCGG39 and 59GTATGCGATGTCTGAACTGGGCCTG39-59CGAC AACCGGGATTCGGTG39, respectively. The Ser833Leu substitution appeared sufficient to confer high-level nalidixic acid resistance (MIC . 250 mg/ml) as determined by standard